Ophthalmology

Editorial Board

2012-05-01

This Issue At A Glance

Lori Baker Schena, John Kerrison — 2012-05-01

Bali et al (p. 891) have demonstrated that while femtosecond lasers increase the ease and predictability of cataract surgery, there exists a distinct learning curve with this procedure. The prospective study involved 6 surgeons performing anterior capsulotomy, lens fragmentation, and corneal incisions with a femtosecond laser on 200 eyes undergoing cataract surgery. The eyes were divided into 4 groups: first 50 cases, 51–100 cases, 101–150 cases, and 151–200 cases. In 5 eyes, suction breaks resulted in the laser procedure being stopped. Other complications included small anterior capsular tags, anterior radial tears, posterior capsular ruptures, and dropped nuclei. Thirty-five eyes had free-floating capsulotomies. The authors identified significant differences among the sequential groups in terms of the number of docking attempts, miosis after the laser procedure, and free-floating capsulotomies, which indicated an improving learning curve. This curve appeared to flatten with prior femtosecond laser experience and adjustments to surgical technique. They call for further studies to determine whether the purported advantages of this approach can be realized.

A Simple Vista en Este Número

Lori Baker Schena, John Kerrison — 2012-05-01

Bali y otros (p. 891) han demostraron que aunque los láseres de femtosegundo aumentan la facilidad y hace hacen más predecible la cirugía de cataratas, este procedimiento tiene una evidente curva de aprendizaje. El estudio prospectivo comprendió 6 cirujanos que practicaron capsulotomía anterior, fragmentación del cristalino e incisión de la córnea con láser de femtosegundo en 200 ojos sometidos a cirugía de cataratas. Los ojos se dividieron en cuatro grupos de 50 casos así: primero hasta el caso 50, segundo de 51–100, tercero de 101–150 y cuarto, de 151–200 casos. En 5 ojos, los desgarros por succión obligaron a suspender el procedimiento con láser. Otras complicaciones incluyeron pequeñas marcas en la cápsula anterior, desgarros radiales anteriores, rupturas de la cápsula posterior y núcleos caídos. Treinta y cinco ojos tuvieron capsulotomías de flotación libre. Los autores identificaron diferencias significativas entre los grupos secuenciales en términos del número de intentos de acoplamiento, miosis después del procedimiento de láser y capsulotomías y flotación libre, lo que indicó una curva de aprendizaje que mejoraba gradualmente. Esta curva pareció aplanarse con una experiencia previa de láser de femtosegundo y ajustes a la técnica quirúrgica. Recomiendan mayores estudios para determinar si se pueden lograr las supuestas ventajas de este abordaje.

This Issue At A Glance

由Lori Baker Schena, 并且John Kerrison — 2012-05-01

Bali et al (p. 891) 等报道, 虽然飞秒激光使白内障手术更加简单, 预测性更高, 但学习曲线截然不同. 这项前瞻性研究中有 6 位手术医生在 200 只眼上施行白内障手术, 用飞秒激光切开前囊膜, 粉碎晶体和做角膜切口. 共分 4 组: 50 例以内, 51∼100 例, 101∼150 例和 151∼200 例. 有 5 只眼因吸力中断而停止激光. 其他并发症包括小的前囊膜碎片, 前囊膜放射状撕裂, 后囊膜破裂和晶体核下沉. 35 只眼有游离漂浮的囊膜碎片. 作者确认, 随着手术量的提高, 4 组之间, 尝试对接次数, 激光治疗后瞳孔缩小例数和游离漂浮前囊膜碎片数量有显著差异, 这些都说明飞秒激光白内障手术存在学习曲线. 积累飞秒激光的经验和调整手术技术后, 曲线变得平坦. 作者呼吁进一步研究以证实飞秒激光的优点.

2012-05-01

Femto Future: Sizzle or Steak?

Roger F. Steinert — 2012-05-01

In physics, the smart remark has long been that lasers are solutions looking for problems. The medical corollary is that lasers are treatments looking for diseases. Ophthalmology has always used lasers, both diagnostic and therapeutic, more than any other medical specialty. Because the eye is an optical medium, the application of laser technology is both logical and poetic justice.

Early Experience with the Femtosecond Laser for Cataract Surgery

2012-02-23

Objective: To describe the intraoperative complications and to evaluate the learning curve with femtosecond laser cataract surgery. Design: Prospective, consecutive cohort study. Participants: The first 200 eyes undergoing femtosecond laser cataract surgery and refractive lens exchange in a single center. Methods: The initial 200 eyes undergoing cataract surgery between April 2011 and June 2011 by 6 surgeons were included in the study. The cases underwent anterior capsulotomy, lens fragmentation, and corneal incisions with the femtosecond laser. The procedure was completed by phacoemulsification and insertion of an intraocular lens. Data were collected about patient demographics, preoperative investigations and intraoperative complications. The cases were divided into 4 groups—group 1 included the first 50 cases, group 2 included cases 51 through 100, group 3 included cases 101 through 150, and group 4 included cases 151 through 200—and were analyzed. Main Outcome Measures: Intraoperative complication rates. Results: The mean age of patients included was 69.2±9.8 years. Of the 200 eyes, 74.5% underwent a complete procedure of laser capsulotomy, lens fragmentation, and corneal incisions. Five eyes had suction breaks during the laser procedure that led to the remainder of the laser procedure being aborted. Twenty-one (10.5%) eyes showed the presence of small anterior capsular tags. The number of eyes with free-floating capsulotomies was 35 (17.5%). The other complications during the study were anterior radial tears (n = 8; 4%), posterior capsular ruptures (n = 7; 3.5%), and dropped nucleus (n = 4; 2%). A significant difference was noted among the sequential groups with respect to the number of docking attempts (P<0.001), miosis after the laser procedure (P<0.001), and free-floating capsulotomies (P<0.001), suggesting an improving learning curve. The surgeons with prior experience with femtosecond lasers had fewer complications in the first 100 cases (P<0.001). No difference in complications was observed after the initial 100 cases. Conclusions: In this case series, there was a clear learning curve associated with the use of femtosecond lasers for cataract surgery. Adjustment to surgical technique and prior experience with a femtosecond laser seemed to flatten the learning curve. Financial Disclosure(s): Proprietary or commercial disclosure may be found after the references.

Genetic Polymorphisms in DNA Repair Genes OGG1, APE1, XRCC1, and XPD and the Risk of Age-Related Cataract

2012-02-06

Purpose: To analyze the association of the polymorphisms in 8-oxoguanine glycosylase-1 (OGG1), X-ray repair cross-complementing-1 (XRCC1), and AP endonuclease-1 (APE1) genes in the base excision repair pathway and xeroderma pigmentosum complementation group D (XPD) in the nucleotide excision repair pathway with the risk of cataract in a Chinese population. Design: Case-control study. Participants: Subjects with cataract (n = 415) or no cataract (n = 386) in the Age Related Eye Disease Ancillary Study. Methods: The study included 415 cataract patients and 386 controls. Genotyping was carried out by the polymerase chain reaction–restriction fragment length polymorphism method. Differences in the frequencies were estimated by the chi-square test, and risk was estimated by using unconditional logistic regression after adjusting for age and gender. Main Outcome Measures: Association of single nucleotide polymorphisms in OGG1-Ser326Cys with the development of age-related cataract. Results: The OGG1 Cys/Cys genotype frequency was significantly higher in cataract patients (P = 0.014; odds ratio [OR], 2.06; 95% confidence interval [CI], 1.171–3.624). The OGG1 Ser/Ser genotype (P = 0.003; OR, 0.647; 95% CI, 0.487–0.860) seems to have a protective role against cataract, and the Cys allele (P<0.001; OR, 1.517; 95% CI, 1.204–1.911) seems to have a deleterious role in the development of cataract. The genotype frequency of the Ser/Ser of OGG1-Ser326Cys was significantly different in the cortical and mixed-type cataract group (P = 0.014; OR, 0.591; 95% CI, 0.391–0.893; and P = 0.035; OR, 0.639; 95% CI, 0.425–0.960; respectively), and the Cys/Cys genotype of OGG1-Ser326Cys was significantly different in the mixed-type cataract group (P = 0.012; OR, 2.610; 95% CI, 1.284–5.306) compared with that of healthy controls. In XRCC1-Arg399Gln, APE1-Asp148Glu, and XPD-Lys751Gln polymorphisms, there were no significant differences in frequencies of the variant homozygous in patients compared with controls. Conclusions: Results suggest that the Cys/Cys genotype of the OGG1-Ser326Cys polymorphism may be associated with increased risk of age-related cataract. However, in XRCC1-Arg399Gln, APE1-Asp148Glu, and XPD-Lys751Gln polymorphisms, there were no significant differences in frequencies of the variant homozygous in patients compared with controls. Financial Disclosure(s): The author(s) have no proprietary or commercial interest in any materials discussed in this article.

Pathologic Assessment of Complications with Asymmetric or Sulcus Fixation of Square-Edged Hydrophobic Acrylic Intraocular Lenses

2012-03-16

Objective: One-piece hydrophobic acrylic intraocular lenses (IOLs) are not indicated for sulcus fixation because of complications, such as uveitis-glaucoma-hyphema syndrome. Similar complications may also be observed with 3-piece lenses that have a square optic edge on the anterior surface. The objective of this study was to provide pathologic evidence of complications related to out-of-the-bag fixation of 1- or 3-piece hydrophobic acrylic IOLs with anterior and posterior square optic edges. Design: Comparative case series with pathology. Participants: A total of 661 pseudophakic cadaver eyes obtained from eye banks within the United States, implanted with different IOLs. Methods: Anterior segment scanning of whole eyes with a high-frequency ultrasound system or high-resolution anterior segment magnetic resonance imaging, followed by gross examination. Selected eyes were processed for complete histopathologic analysis; some of them were explanted before histopathology to allow for direct light microscopic evaluation of the lenses. Main Outcome Measures: Findings from imaging, gross, and histopathologic evaluation that could be related to out-of-the-bag fixation of the lenses. Results: A total of 256 eyes were implanted with hydrophobic acrylic IOLs with anterior and posterior square optic edges; 18 of them exhibiting asymmetric or sulcus IOL fixation (six 1-piece and twelve 3-piece IOLs) underwent complete histopathologic evaluation and were compared with the contralateral eyes with symmetric in-the-bag IOL implantation. Pathologic findings were composed of IOL decentration and tilt, pigmentary dispersion within the anterior segment and on the IOL surface, iris transillumination defects, iris changes including vacuolization/disruption/loss of the pigmented layer, iris thinning, and iris atrophy, as well as synechiae and loop erosion in the case of 3-piece lenses. Findings were more significant in comparison with the control contralateral eyes and were particularly evident in relation to the sulcus-fixated haptic in the case of 1-piece lenses. The majority of the eyes with 3-piece lenses showed signs of complicated surgery. Conclusions: This study provides pathologic correlation of complications that were clinically reported in the peer-reviewed literature in relation to sulcus fixation of 1-piece hydrophobic acrylic IOLs. The eyes with 3-piece lenses generally exhibited evidence of complicated surgery; therefore, all pathologic findings in those cases may not be strictly attributed to the out-of-the-bag fixation. Financial Disclosure(s): Proprietary or commercial disclosure may be found after the references.

Postcataract Surgery Endophthalmitis in the United States: Analysis of the Complete 2003 to 2004 Medicare Database of Cataract Surgeries

Lisa Keay, Emily W. Gower, Sandra D. Cassard, James M. Tielsch, Oliver D. Schein — 2012-02-01

Objective: To estimate endophthalmitis incidence after cataract surgery nationally and at the state level in 2003 and 2004 and to explore risk factors. Design: Analysis of Medicare beneficiary claims data. Participants: We evaluated billed claims for cataract surgery and endophthalmitis diagnosis and treatment for all Medicare fee-for-service beneficiaries in 2003-2004. Methods: Cataract surgeries were identified by procedure codes and merged with demographic information. Cataract annual surgical volume was calculated for all surgeons. Presumed postoperative endophthalmitis cases were identified by International Classification of Diseases-9 Clinical Modification Codes on claims within 42 days after surgery. Endophthalmitis rates and 95% confidence intervals (CI) were calculated at state and national levels. Logistic regression was used to investigate the association between developing endophthalmitis and surgery location and surgeon factors. Main Outcome Measures: Endophthalmitis incidence and risk factors. Results: We included 4006 cases of presumed endophthalmitis, which occurred after 3 280 966 cataract surgeries. The national rate in 2003 was 1.33 per 1000 surgeries (95% CI, 1.27–1.38) and decreased to 1.11 per 1000 (95% CI, 1.06–1.16) in 2004. Males (relative risk [RR], 1.23; 95% CI, 1.15–1.31), older individuals (RR, 1.53; 95% CI, 1.38–1.69; ≥85 compared with 65–74 years), blacks (RR, 1.17; 95% CI, 1.03–1.33), and Native Americans (RR, 1.72; 95% CI, 1.07–2.77) had increased risk of disease. After adjustment, surgeries by surgeons with low annual volume (RR, 3.80; 95% CI, 3.13–4.61 for 1–50 compared with ≥1001 annual surgeries) and less experience (RR, 1.41; 95% CI, 1.25–1.59 for 1–10 compared with ≥30 years), and surgeries performed in 2003 (RR, 1.20; 95% CI, 1.13–1.28) had increased endophthalmitis risk. Conclusions: Endophthalmitis rates are lower than previous yearly US estimates, but remain higher than rates reported from a series of studies from Sweden; patient factors or methodologic differences may contribute to differences across countries. Patient age, gender, and race, and surgeon volume and years of experience are important risk factors. Financial Disclosure(s): The authors have no proprietary or commercial interest in any of the materials discussed in this article.

Comparative Study of Limbal Stem Cell Deficiency Diagnosis Methods: Detection of MUC5AC mRNA and Goblet Cells in Corneal Epithelium

2012-01-31

Purpose: To evaluate a limbal stem cell deficiency (LSCD) diagnosis method based on the detection of the MUC5AC transcript by reverse transcription-polymerase chain reaction (RT-PCR) in comparison with the standard diagnostic method based on goblet cell detection by periodic acid-Schiff (PAS)–hematoxylin staining, using samples obtained from corneal epithelium impression cytology (IC). Design: Transversal, comparative case series. Participants: We studied 59 eyes from 43 patients clinically diagnosed with LSCD. Methods: Impression cytology was used to gather cells from corneal and conjunctival epithelium from the same eye. The presence of goblet cells in the cornea was determined by PAS-hematoxylin staining, whereas the presence of the MUC5AC transcript was detected by RT-PCR using a custom-designed primer pair. Main Outcome Measures: Goblet cells in the corneal epithelium were detected by light microscopy, and the MUC5AC transcript was detected as the corresponding PCR amplicon in agarose gels. Results: Our study included 59 corneal samples, together with their respective conjunctival samples for RT-PCR assays. Of these, 47 samples were also available for comparative PAS-hematoxylin staining. The MUC5AC amplicon was detected in 56 of 59 (94.9%) corneal epithelium samples. In contrast, conventional IC staining detected goblet cells in only 17 of 47 (36.2%) samples; these were not found in 27 of 47 (57.4%) samples (negative results), and 3 of 47 (6.4%) showed inconclusive results. Conclusions: The detection of the MUC5AC transcript in corneal epithelium is a more sensitive method to diagnose LSCD than the conventional PAS-hematoxylin method, although a minimum RNA concentration of 1.2 ng/μl is required for negative results to be reliable. Moreover, RT-PCR is a highly specific and more objective technique. Overall, these findings indicate that molecular analysis facilitates a more precise clinical diagnosis of LSCD, thereby reducing the risk of surgical failure. Financial Disclosure(s): Proprietary or commercial disclosure may be found after the references.

Allogenic Limbo-keratoplasty with Conjunctivoplasty, Mitomycin C, and Amniotic Membrane for Bilateral Limbal Stem Cell Deficiency

2012-02-13

Objective: To present the technique and report the results of up to 36 months after allogenic central penetrating limbo-keratoplasty in conjunction with conjunctivoplasty, mitomycin C (MMC), and amniotic membrane (AM) transplantation in patients with bilateral limbal stem cell deficiency (LSCD). Design: Retrospective, consecutive subject cohort study. Participants: Case records of 20 eyes from 20 patients who presented with bilateral LSCD due to aniridia, chemical/thermal burn, cicatrizing pemphigoid, and chronic ocular surface inflammation and who were treated at the University Eye Hospital, Freiburg. Methods: All eyes were treated with central limbo-keratoplasty in conjunction with conjunctivoplasty, MMC, and AM. There were 20 human leukocyte antigen-typed allolimbal transplants from cadaveric donors. All patients received systemic immunosuppression with mycophenolate mofetil or cyclosporine A. Main Outcome Measures: Surgical success was measured by the duration for which a healthy corneal epithelium was maintained. Visual success was measured by an improvement in visual acuity (VA) in the eye during follow-up and directly correlated with central clear graft survival. Results: The follow-up period was up to 34 months (mean, 20 months; median, 22.4 months). Mean VA, measured in decimal fractions, increased from 0.029 (∼20/400; median, 0.005; first quartile 0.005; third quartile 0.005) before surgery to 0.281 (20/70; median, 0.2; first quartile 0.04; third quartile 0.55) after surgery. Healthy corneal epithelium showing survival of limbal stem cells was observed in 14 eyes (70%) during complete follow-up. Conclusions: Penetrating limbo-keratoplasty with conjunctivoplasty, MMC, and AM transplantation is a promising new surgical technique for improving vision and conjunctivalization in patients with severe bilateral LSCD necessitating allogenic transplants. Financial Disclosure(s): The author(s) have no proprietary or commercial interest in any materials discussed in this article.

Giant Ocular Surface Squamous Neoplasia Managed with Interferon Alpha-2b as Immunotherapy or Immunoreduction

H. Jane Kim, Carol L. Shields, Sanket U. Shah, Swathi Kaliki, Sara E. Lally — 2012-02-23

Objective: To evaluate the efficacy of interferon alpha-2b (IFNα2b) for extensive ocular surface squamous neoplasia (OSSN). Design: Retrospective, interventional case series. Participants: Eighteen eyes in 18 patients. Methods: Each patient with giant OSSN (a single tumor ≥15 mm basal diameter or ≥6 limbal clock-hours) was managed with topical IFNα2b (1 million IU/ml) 4 times daily or with injection IFNα2b (a portion of 10 million IU/ml vial) with follow-up every 1 to 3 months. Main Outcome Measures: Tumor response, recurrence, and treatment complications were evaluated. Results: Eighteen patients with giant OSSN (median diameter [MD], 20 mm; median clock-hours [MCH], 6) were treated with topical IFNα2b (n = 12), injection IFNα2b (n = 3), or both (n = 3). The IFNα2b achieved complete tumor control (immunotherapy) in 13 eyes and partial tumor control with reduction in size (immunoreduction) in 5 eyes. Topical IFNα2b alone (n = 12) provided complete immunotherapy in 7 eyes (MD, 12 mm; MCH, 9) over a median period of 5 months and immunoreduction by 74% in 5 eyes (MD, 20 mm; MCH, 3), allowing for subsequent surgical excision (n = 3), photodynamic therapy (n = 1), or cryotherapy (n = 1) for tumor control. Injection IFNα2b alone (n = 3; median, 1 injection) provided complete control of giant tarsal conjunctival OSSN (MD, 20 mm) over a 1-month period. A combination of topical and injection IFNα2b (n = 3; median, 3 injections) completely resolved larger tumors (MD, 30 mm; MCH, 6) over a 6-month period. Complications of IFNα2b included transient flu-like symptoms (n = 3), corneal epithelial defect (n = 2), and conjunctival hyperemia (n = 1). During a median follow-up of 11 months, there were no tumor recurrences, but 2 new tumors appeared at a remote site from the original tumor, requiring operative intervention. Conclusions: In 72% of giant OSSNs IFNα2b achieved complete control (immunotherapy); there was a reduction in size (immunoreduction) in 28% of giant OSSNs. Financial Disclosure(s): The authors have no proprietary or commercial interest in any of the materials discussed in this article.

New Strategy for Rapid Diagnosis and Characterization of Keratomycosis

2012-02-20

Purpose: The first-line therapy for patients with keratitis is different for bacteria, filamentous fungi, and yeasts. The timely onset of treatments depends on rapid and accurate diagnosis. However, fungal cultures produce high rates of false-negative results. Nucleic acid amplification techniques (polymerase chain reaction [PCR]) improve fungal diagnosis performance, but they require complex postamplification procedures to differentiate filamentous fungi from yeasts or to identify the agent. The objective of this work was to develop a new diagnostic strategy based on real-time PCR high-resolution melting (HRM) analysis that in 1 run (a) detects and semiquantifies yeasts and filamentous fungi, (b) differentiates yeasts from filamentous fungi, and (c) discriminates among relevant species of yeasts. Design: Experimental study to compare HRM diagnosis performances with microscopic examination of corneal scrapings and fungal culture. Participants and Controls: High-resolution melting detection limits and specificity were assessed with (a) isolated strains; (b) agents (other than fungi) producing keratitis; (c) corneal scrapings from fungal keratitis (culture positive and negative); and (d) corneal scrapings from bacterial, viral, or Acanthamoeba keratitis. Methods: The DNA extracted from cornea specimens was mixed with primers diluted in the MeltDoctor HRM Master Mix (Applied Biosystems, Paris, France) in 2 tubes, the first for yeasts, containing the forward primer CandUn (5′CATGCCTGTTTGAGCGTC) and the reverse primer FungUn2 (5′TCCTCCGCTTATTGATATGCT), and the second for filamentous fungi, containing the forward primer FilamUn1 (5′TGCCTGTCCGAGCGTCAT) and FungUn2. Molecular probes were not necessary. The yields of DNA extraction and the PCR inhibitors were monitored by adding internal controls to each sample. Main Outcome Measures: Detection of fungi in corneal samples by HRM. Results: High-resolution melting consistently detects the equivalent of 0.1 colony-forming units /ml of yeasts and filamentous fungi, differentiates filamentous fungi from yeasts, and discriminates among relevant species of yeasts. High-resolution melting sensitivity and specificity were 100% for culture-positive samples, detecting and characterizing fungi in 7 of 10 culture-negative suspected fungal keratitis. Conclusions: High-resolution melting is a new, sensitive, specific, and inexpensive test that detects fungi and differentiates filamentous fungi from yeasts directly from clinical specimens in less than 2.30 hours after DNA extraction. Financial Disclosure(s): The author(s) have no proprietary or commercial interest in any materials discussed in this article.

Risk Factors for the Development of Retroprosthetic Membranes with Boston Keratoprosthesis Type 1: Multicenter Study Results

2012-02-23

Objective: The purpose of this study was to identify possible risk factors for retroprosthetic membrane (RPM) development in a large, multicenter cohort of patients receiving a Boston type 1 keratoprosthesis. Design: Cohort study. Participants: The final analysis included 265 eyes of 265 patients who underwent implantation of a Boston keratoprosthesis type I device between January 2003 and July 2008 by 1 of 19 surgeons at 18 medical centers. Methods: Forms reporting preoperative, intraoperative, and postoperative parameters were prospectively collected and subsequently analyzed at a central data collection site. Main Outcome Measures: The primary outcome was the presence or absence of an RPM during the follow-up period. Results: The average age of patients was 63.3±19.1 years, 48.5% of the patients were female, and 52.5% of procedures were performed on the right eye. The mean follow-up time was 17.8±14.9 months. The majority (85.4%; n = 222) had undergone an average of 2.2±1.2 (range, 1–8) penetrating keratoplasties before keratoprosthesis implantation, and 38 eyes (14.6%) received a primary keratoprosthesis. The overall RPM formation rate was 31.7% (n = 84). The most significant risk factor for RPM development was infectious keratitis (as a surgical indication for keratoprosthesis surgery itself), resulting in a rate of RPM formation of 70.6%. As an independent risk factor, the hazard ratio (HR) of RPM development in these eyes was 3.20 (95% confidence interval, 1.66–6.17). Aniridia was also an independent risk factor for RPM development (HR, 3.13; 95% confidence interval, 1.10–8.89). Conclusions: Formation of RPM is a common complication of keratoprosthesis surgery, occurring in approximately one-third of cases. Eyes at the highest risk of RPM development are those receiving corneal replacement for infectious keratitis and aniridia. Financial Disclosure(s): The authors have no proprietary or commercial interest in any of the materials discussed in this article.

Mapping the Nerve Architecture of Diabetic Human Corneas

Jiucheng He, Haydee E.P. Bazan — 2012-02-10

Objective: To investigate the entire human corneal nerve architecture of donors with different durations of insulin-dependent diabetes mellitus (IDDM). Design: Experimental study. Participants and Controls: Sixteen fresh human eyes from 8 diabetic donors (aged 43–66 years, with IDDM for 2–17 years) and 12 eyes from 6 normal donors (aged from 44–67 years) were obtained from the National Disease Research Interchange (NDRI). Methods: After fixation, corneas were stained with mouse monoclonal anti-β-Tubulin III antibody, and images were acquired to build a whole view of the corneal nerve architecture. The same corneas were used for both whole-mount and cross-section examination. Main Outcome Measures: Corneal epithelial nerve density was calculated on the basis of the whole-mount view of the central area. The number of stromal nerves was calculated by counting the nerve trunks at the corneoscleral limbus of the entire cornea. Differences between diabetic and normal corneas in epithelial nerve densities and main stromal nerve numbers were compared by paired-samples t test. Results: The diabetic eyes presented numerous neuropathies in areas where the epithelial nerve bundles emerged. A striking pathologic change was the presence of abundant nerve fiber loops in the stroma. These loops seemed to form by resistance presented by the basement membrane, which may prevent penetration of stromal nerve branches into epithelia. There was no difference in the numbers of main stromal nerve trunks between corneas from diabetic and normal donors, but there was a significant decrease in central epithelial nerve density in the diabetic corneas. We did not find an age effect on this decrease. Instead, it was significantly affected by 5 or more years of IDDM. Conclusions: This is the first study to show an entire view of the nerve architecture in human diabetic corneas. The decreased epithelial nerve density may result from the abnormalities of stromal nerve architecture and is affected by 5 or more years of IDDM. Although compensation for some nerve regeneration takes place, the alterations in the stromal nerves can explain the poor healing and persistent epithelial defects seen in diabetic patients. Financial Disclosure(s): The author(s) have no proprietary or commercial interest in any materials discussed in this article.

Oral Alcohol Administration Disturbs Tear Film and Ocular Surface

2012-02-13

Purpose: To investigate whether ethanol administration disturbs the tear film and ocular surface. Design: Case-control study. Participants: Twenty healthy male subjects were recruited. Ethanol was administered to 10 subjects and another 10 subjects served as controls. Methods: Twenty healthy male subjects with no ocular disease were recruited. Ethanol (0.75 g/kg) was administered orally at 8 pm for 2 hours to 10 subjects. Main Outcome Measures: The tear film and ocular surface were evaluated at 6 pm before drinking, at midnight, and immediately (6 am) and 2 hours (8 am) after waking the next morning. Tear osmolarity, ethanol concentration in tears and serum, Schirmer's test results, tear film break-up time (TBUT), corneal punctuate erosion, and corneal sensitivity were measured. Results: Ethanol was detected in tears and serum at midnight, but it was not detected the next morning. The mean tear osmolarity level increased in the alcohol group at midnight compared with that in the control group (P<0.001). The alcohol group showed a significantly shorter TBUT compared with the control group after drinking alcohol (P<0.001 at 12 am, P<0.001 at 6 am, and P = 0.002 at 8 am). There were significantly higher fluorescein staining scores in the alcohol group compared with those in the control group at 6 am and 8 am (P = 0.001 and P<0.001, respectively). No significant change was shown in corneal sensitivity or Schirmer's test results in either group. Conclusions: Orally administered ethanol was secreted into the tears. Ethanol in tears induced tear hyperosmolarity and shortened TBUT and triggered the development of ocular surface diseases. Similar changes could exacerbate signs and symptoms in patients with ocular surface disease. Financial Disclosure(s): The author(s) have no proprietary or commercial interest in any materials discussed in this article.

Caffeine Increases Tear Volume Depending on Polymorphisms within the Adenosine A2a Receptor Gene and Cytochrome P450 1A2

2012-02-15

Purpose: The primary aim of the present study was to examine the effect of caffeine on tear volume. The secondary aim was to investigate the relation between caffeine-induced changes in tear volume and polymorphisms in ADORA2A and CYP1A2. Design: Double-masked, placebo-controlled, crossover study. Participants: Seventy-eight healthy volunteers were recruited for the study. Methods: Subjects participated in 2 sessions in which they received capsules containing either placebo or caffeine. The caffeine capsules were given to the subjects to keep the caffeine volume per body weight within 5 to 7 mg/kg. After caffeine intake, tear meniscus height (TMH) was measured. Subjects provided a blood sample for genotyping. Main Outcome Measures: Tear meniscus height, single nucleotide polymorphism. Results: The tear volume increased after caffeine consumption. The net increase in TMH was 0.08 mm (95% confidence interval, 0.05–0.10) greater when participants were given caffeine than when given placebo (P<0.0001). In ADORA2A, the difference in the net increase in TMH for participants who were heterozygous at rs5751876 and rs2298383 was 0.07 mm (P = 0.001) and who were minor homozygous was 0.08 mm (P = 0.007). In CYP1A2, the net increase in TMH for participants who were minor homozygous at rs2472304 was lower than for those who were major homozygous; the difference was 0.06 mm (P = 0.039). Conclusions: Caffeine intake increases tear volume and polymorphisms within ADORA2A, and CYP1A2 is associated with the tear increase after caffeine intake. Genetic polymorphisms had a significant effect on tear meniscus that was of limited clinical significance. Financial Disclosure(s): The authors have no proprietary or commercial interest in any of the materials discussed in this article.

Glaucoma 2.0: Neuroprotection, Neuroregeneration, Neuroenhancement

Elma E. Chang, Jeffrey L. Goldberg — 2012-02-20

Glaucoma is a progressive neurodegenerative disease of retinal ganglion cells (RGCs) associated with characteristic axon degeneration in the optic nerve. Clinically, our only method of slowing glaucomatous loss of vision is to reduce intraocular pressure (IOP), but lowering IOP is only partially effective and does not address the underlying susceptibility of RGCs to degeneration. We review the recent steps forward in our understanding of the pathophysiology of glaucoma and discuss how this understanding has given us a next generation of therapeutic targets by which to maintain RGC survival, protect or rebuild RGC connections in the retina and brain, and enhance RGC function. Financial Disclosure(s): The author(s) have no proprietary or commercial interest in any materials discussed in this article.

Effect of Head and Body Position on Intraocular Pressure

Mehrdad Malihi, Arthur J. Sit — 2012-02-20

Objective: To investigate the effect of different head and body positions on intraocular pressure (IOP) in a randomized study. Design: Prospective, comparative case series. Participants: Twenty-four healthy volunteers. Methods: Subjects had 2 sets of IOP measurements performed, sitting and recumbent, with the order of these sets of measurements randomized. In the sitting position, IOP was measured in neutral neck position, neck extension, and neck flexion, with the order of measurements randomized. In the recumbent positions, IOP was measured in the supine position, and right and left lateral decubitus positions, with the order of measurements also randomized. All IOP measurements were performed with pneumatonometry. Results: Mean IOP of right and left eyes while sitting with the neck in neutral position was 14.8±2.0 mmHg, which was significantly lower than IOP measured with neck flexion or extension or in the recumbent positions. As well, IOP in neck flexion was significantly higher than IOP in neck extension (all P<0.0001). The IOP was higher in the dependent eye when measured in the right lateral decubitus position (18.8±2.9 vs 17.7±3.1 mmHg; P = 0.016), but did not attain significance in the left lateral decubitus position (P = 0.076). Conclusions: In normal subjects, IOP is lowest when measured while sitting with the neck in the neutral position. All other head and body positions result in an elevation of IOP compared with the position used for typical clinical measurements. Lateral decubitus positions may result in a small increase in the IOP in the lower eye. Further research is required to determine whether similar elevations of IOP occur in glaucoma patients, and elucidate the clinical significance of these elevations. Financial Disclosure(s): The authors have no proprietary or commercial interest in any of the materials discussed in this article

Verteporfin plus Ranibizumab for Choroidal Neovascularization in Age-related Macular Degeneration: Twelve-month MONT BLANC Study Results

2012-03-19

Purpose: To compare the efficacy and safety of same-day verteporfin photodynamic therapy (PDT) and intravitreal ranibizumab combination treatment versus ranibizumab monotherapy in neovascular age-related macular degeneration. Design: Prospective, multicenter, double-masked, randomized, active-controlled trial. Participants: We included 255 patients with all types of active subfoveal choroidal neovascularization. Methods: Patients were randomized 1:1 to as-needed (pro re nata; PRN) combination (standard-fluence verteporfin 6 mg/m2 PDT and ranibizumab 0.5 mg) or PRN ranibizumab monotherapy (sham infusion [5% dextrose] PDT and ranibizumab 0.5 mg). Patients received 3 consecutive monthly injections followed by PRN retreatments based on protocol-specific retreatment criteria. Main Outcome Measures: Mean change in best-corrected visual acuity (BCVA) from baseline to month 12, and the proportion of patients with treatment-free interval ≥3 months at any timepoint after month 2. Results: The mean change in BCVA at month 12 was +2.5 and +4.4 letters in the combination and monotherapy groups, respectively (P = 0.0048; difference: −1.9 letters [95% confidence interval, −5.76 to 1.86], for having achieved noninferiority with a margin of 7 letters). The proportion of patients with a treatment-free interval of ≥3 months at any timepoint after month 2 was high, but did not show a clinically relevant difference between the treatment groups. Secondary efficacy endpoints included the mean number of ranibizumab retreatments after month 2 (1.9 and 2.2 with combination and monotherapy, respectively [P = 0.1373]). The time to first ranibizumab retreatment after month 2 was delayed by 34 days (about 1 monthly visit) with combination (month 6) versus monotherapy (month 5). At month 12, mean ± standard error central retinal thickness decreased by 115.3±9.04 μm in the combination group and 107.7±11.02 μm in the monotherapy group. The mean number of verteporfin/sham PDT treatments was comparable in the 2 groups (combination, 1.7; monotherapy, 1.9). The safety profiles of the 2 groups were comparable, with a low incidence of ocular serious adverse events. Conclusions: The combination PRN treatment regimen with verteporfin PDT and ranibizumab was effective in achieving BCVA gain comparable with ranibizumab monotherapy; however, the study did not show benefits with respect to reducing the number of ranibizumab retreatment over 12 months. The combination therapy was well tolerated. Financial Disclosure(s): Proprietary or commercial disclosures may be found after the references.

Verteporfin plus Ranibizumab for Choroidal Neovascularization in Age-Related Macular Degeneration: Twelve-Month Results of the DENALI Study

2012-03-23

Purpose: To demonstrate noninferiority of ranibizumab in combination with verteporfin photodynamic therapy (PDT) versus ranibizumab monotherapy in patients with subfoveal choroidal neovascularization secondary to age-related macular degeneration (AMD). Design: Prospective, multicenter, double-masked, randomized, phase IIIb clinical trial. Participants: Three hundred twenty-one patients randomized to receive either ranibizumab 0.5 mg monotherapy (n = 112), standard fluence (SF) verteporfin PDT combination therapy (n = 104), or reduced fluence (RF) verteporfin PDT combination therapy (n = 105). Methods: Ranibizumab was administered monthly in the monotherapy group. In both combination therapy groups, ranibizumab was initiated with 3 consecutive monthly injections, followed by retreatment as needed (pro re nata) with monthly monitoring. All patients were evaluated monthly for 12 months. Main Outcome Measures: Mean change in best-corrected visual acuity (BCVA) from baseline at month 12 and proportion of patients randomized to either combination therapy with a ranibizumab treatment-free interval of 3 months or longer. Results: Two hundred eighty-six patients (89.1%) completed the 12-month study. Mean BCVA change at month 12 was +5.3 and +4.4 letters with verteporfin SF (n = 103) or verteporfin RF (n = 105) plus ranibizumab, respectively, compared with +8.1 letters with ranibizumab monotherapy (n = 110; adjusted 97.5% confidence interval [CI], (−7.90 to infinity); P = 0.0666; and 97.5% CI, (−8.51 to infinity); P = 0.1178; for combination regimens vs. monotherapy, respectively). Noninferiority of either combination regimen to monthly ranibizumab monotherapy was not demonstrated (primary end point). A ranibizumab treatment-free interval of 3 months or longer was achieved in 92.6% and 83.5% of the patients randomized to verteporfin SF or verteporfin RF groups, respectively, with a mean of 5.1 and 5.7 ranibizumab injections, respectively, and patients in the ranibizumab monotherapy arm received 10.5 injections. At month 12, mean central retinal thickness decreased by 151.7 μm and 140.9 μm for the verteporfin SF and RF groups, respectively, and by 172.2 μm with ranibizumab monotherapy. Safety and tolerability of all 3 regimens were similar to and consistent with previous studies in neovascular AMD. The number of ocular serious adverse events was low and occurred largely as single cases. Conclusions: Ranibizumab monotherapy or combined with verteporfin PDT improved BCVA at month 12; however, noninferiority (7-letter margin) of combination regimens to ranibizumab monotherapy was not demonstrated. Verteporfin RF did not confer clinical benefits over verteporfin SF. All treatments were well tolerated. Financial Disclosure(s): Proprietary or commercial disclosure may be found after the references.

Yellow Corneal Ring Associated with Vitamin Supplementation for Age-Related Macular Degeneration

Andrew W. Eller, Ian R. Gorovoy, Vera A. Mayercik — 2012-02-13

Purpose: To report the first described cases of peripheral yellow corneal rings secondary to vitamin supplementation for age-related macular degeneration (ARMD). Design: Retrospective single-center case series. Participants: The eyes of 4 patients taking vitamin supplementation for ARMD were examined at the University of Pittsburgh Medical Center Department of Ophthalmology between January 2010 and April 2011. Methods: We reviewed the medical records of 4 patients with peripheral corneal rings receiving vitamin supplementation for ARMD. Main Outcome Measures: The presence of peripheral yellow corneal rings, skin findings, and serum carotene levels. Results: Each patient had circumferential, yellow, peripheral corneal rings and exhibited subtle yellowing of the skin most notable on the palms. Serum carotene levels were normal in 2 of the 3 patients and markedly elevated in the last patient in whom it was measured. Conclusions: It is unclear at this time how to counsel patients with this ocular finding. We suspect that these rings are more common than generally appreciated because they may have a subtle appearance or be misdiagnosed as arcus senilis. We suggest that a formal study be performed on a cohort of patients taking vitamin supplementation for macular degeneration that specifically screens for yellow rings and measures serum carotene levels when they are identified. Financial Disclosure(s): The author(s) have no proprietary or commercial interest in any materials discussed in this article.

Choroidal Thickness and Volume Mapping by a Six Radial Scan Protocol on Spectral-Domain Optical Coherence Tomography

Joong Won Shin, Yong Un Shin, Byung Ro Lee — 2012-01-25

Purpose: To report a 6 radial scan protocol, which simply generates a topographic map of choroidal thickness and volume on a commercial spectral-domain optical coherence tomography (SD-OCT) device. We analyzed the features of the resulting choroidal maps in healthy eyes. Design: Prospective, noncomparative case series. Participants: Eighty eyes from 40 healthy volunteers who visited the healthcare clinic of Hanyang University Hospital from December 2010 to February 2011. Methods: All participants underwent a 6 radial scanning protocol using an SD-OCT device. In a single session, the device produces 6 high-resolution averaging B-scan images. For segmentation of the choroid layer, the reference lines of the retinal boundary (internal limiting membrane–retinal pigment epithelium) were adjusted to the choroidal boundary (retinal pigment epithelium–choroid/sclera junction) in each of the 6 radial B-scans. A topographic map of choroidal thickness and volume was automatically generated by built-in software according to the Early Treatment Diabetic Retinopathy Study (ETDRS) layout. A statistical analysis was conducted to compare the choroidal thickness and volume measurements for each ETDRS subfield. Main Outcome Measures: An ETDRS-style topographic map of choroidal thickness and volume. Results: The mean time required for segmentation adjustment was 167.4±15.8 seconds. The mean choroidal thickness of all ETDRS subfields was 285.9±53.0 μm, and the mean total choroidal volume of the entire ETDRS area was 7.72±1.2 mm3. The nasal outer macula area was significantly smaller than any other ETDRS subfield (P<0.05) except for the adjacent superior and inferior outer macula subfields. Refractive error was correlated with choroidal thickness in all ETDRS subfields. Age was also correlated with choroidal thickness for almost all of the ETDRS subfields except for the temporal inner, nasal outer, and temporal outer macula areas. The total choroidal volume was correlated with the refractive error and age. Conclusions: A 6 radial scan protocol, using a commercial SD-OCT device, enables the production of reliable choroidal thickness and volume maps with an ETDRS layout. By using this protocol, more comprehensive choroidal evaluation is possible in clinical practice or research. Financial Disclosure(s): The author(s) have no proprietary or commercial interest in any materials discussed in this article.

Vascular Endothelial Growth Factor Trap-Eye for Macular Edema Secondary to Central Retinal Vein Occlusion: Six-Month Results of the Phase 3 COPERNICUS Study

2012-03-22

Objective: To assess the efficacy and safety of intravitreal vascular endothelial growth factor (VEGF) Trap-Eye in eyes with macular edema secondary to central retinal vein occlusion (CRVO). Design: Multicenter, randomized, prospective, controlled trial. Participants: One hundred eighty-nine eyes with macular edema secondary to CRVO. Methods: Eyes were randomized 3:2 to receive VEGF Trap-Eye 2 mg or sham injection monthly for 6 months. Main Outcome Measures: The proportion of eyes with a ≥15-letter gain or more in best-corrected visual acuity (BCVA) at week 24 (primary efficacy end point), mean changes in BCVA and central retinal thickness (CRT), and proportion of eyes progressing to neovascularization of the anterior segment, optic disc, or elsewhere in the retina. Results: At week 24, 56.1% of VEGF Trap-Eye treated eyes gained 15 letters or more from baseline versus 12.3% of sham-treated eyes (P<0.001). The VEGF Trap-Eye treated eyes gained a mean of 17.3 letters versus sham-treated eyes, which lost 4.0 letters (P<0.001). Central retinal thickness decreased by 457.2 μm in eyes treated with VEGF Trap-Eye versus 144.8 μm in sham-treated eyes (P<0.001), and progression to any neovascularization occurred in 0 and 5 (6.8%) of eyes treated with VEGF Trap-Eye and sham-treated eyes, respectively (P = 0.006). Conjunctival hemorrhage, reduced visual acuity, and eye pain were the most common adverse events (AEs). Serious ocular AEs were reported by 3.5% of VEGF Trap-Eye patients and 13.5% of sham patients. Incidences of nonocular serious AEs generally were well balanced between both groups. Conclusions: At 24 weeks, monthly intravitreal injection of VEGF Trap-Eye 2 mg in eyes with macular edema resulting from CRVO improved visual acuity and CRT, eliminated progression resulting from neovascularization, and was associated with a low rate of ocular AEs related to treatment. Financial Disclosure(s): Proprietary or commercial disclosure may be found after the references.

Rapid Assessment of Avoidable Blindness and Diabetic Retinopathy in Chiapas, Mexico

2012-02-20

Objective: To estimate the prevalence and causes of blindness in Chiapas, Mexico, and to assess the feasibility of using the Rapid Assessment of Avoidable Blindness framework to estimate diabetic retinopathy (DR) prevalence. Design: A cross-sectional population-based survey. Participants: Sixty-six clusters of 50 people 50 years of age or older were selected by probability proportionate to size sampling. Households within clusters were selected through compact segment sampling. Methods: Participants underwent visual acuity (VA) screening and diagnosis of cause of visual impairment by an ophthalmologist. Participants were classed as having diabetes if they had a previous diagnosis of diabetes, were receiving treatment for glucose control, or had a random blood glucose level of more than 200 mg/dl. Participants with diabetes were assessed for DR using dilated clinical examination (direct and indirect ophthalmoscope) and 1 dilated digital fundus photograph per eye (graded by an ophthalmologist during the survey and regraded by a retinal specialist—“reference standard”) following the Scottish DR grading protocol. Main Outcome Measures: Prevalence of blindness (VA <20/400 in the best eye with available correction) and DR. Results: Three thousand three hundred subjects were selected, of whom 2864 (87%) were examined. The estimated prevalence of bilateral blindness was 2.3% (95% confidence interval [CI], 1.7%–2.9%). Cataract was the leading cause of bilateral blindness (63%), followed by posterior segment diseases (24%), which included DR (8% of blindness). The prevalence of diabetes was 21% (19.5%–23.1%). Among participants with diabetes, the prevalence of DR (in at least 1 eye) was 38.9% (95% CI, 33.7%–44.1%). The prevalence of sight-threatening DR (STDR; defined as proliferative DR, referable maculopathy, or both) was 21.0% (95% CI, 16.7%–25.3%). Agreement with the reference standard was good for any retinopathy and STDR for the clinical examination (κ = 0.80 and 0.79, respectively) and the photograph graded during the survey (κ = 0.80 and 0.82, respectively). Conclusions: The prevalence of diabetes and DR in Chiapas was high. Including the DR component was possible, but added considerably to the cost and complexity of the survey, and so would be warranted only if a high prevalence of diabetes is expected and if resources and time permit. Financial Disclosure(s): The author(s) have no proprietary or commercial interest in any materials discussed in this article.

Systemic Soluble Tumor Necrosis Factor Receptors 1 and 2 Are Associated with Severity of Diabetic Retinopathy in Hispanics

2012-02-13

Purpose: To investigate the associations of serum amyloid A (SAA) protein and soluble tumor necrosis factor receptors 1 and 2 (sTNF-R1 and sTNF-R2) with diabetic retinopathy (DR) in Hispanics. Design: Prospective, nonrandomized, cross-sectional, family-based observational cohort study. Participants: A total of 473 Hispanic type II diabetic subjects in families ascertained via proband with DR. Methods: Levels of SAA, sTNF-R1, and sTNF-R2 were measured with enzyme-linked immunosorbent assay. Diabetic retinopathy was assessed by fundus photography and graded using modified Airlie House classification. Main Outcome Measures: Levels of SAA, sTNF-R1, and sTNF-R2 to severity of DR with and without covariates. Results: A direct association of sTNF-R1 (2.37±0.13, 2.15±0.09, 3.09±0.24, 3.25±0.46, 5.02±0.61 ng/ml; P < 0.0001) and sTNF-R2 (6.04±0.20, 6.25±0.52, 7.96±0.70, 8.14±1.13, 14.83±1.68 ng/ml; P < 0.0001) was found for no DR, mild nonproliferative DR (NPDR), moderate NPDR, severe NPDR, and proliferative DR, respectively. These associations remained significant after adjusting for age, gender, body mass index, glycosylated hemoglobin, diabetes duration, systolic blood pressure, and serum creatinine (P < 0.0001 for sTNF-R1 and P=0.0004 for sTNF-R2). A similar pattern was observed when we adjusted for urinary albumin:creatinine ratio in place of serum creatinine (P=0.005 for sTNF-R1 and P=0.02 for sTNF-R2). Conclusions: Levels of sTNF-R1 and sTNF-R2 are highly correlated with the severity of DR, suggesting that inflammation and insulin resistance may play a critical role in the development of DR. These may be useful biomarkers for DR, aiding in etiologic studies and possibly identifying at-risk patients for active intervention. Financial Disclosure(s): The author(s) have no proprietary or commercial interest in any materials discussed in this article.

Relationship between Fluorescein Pooling and Optical Coherence Tomographic Reflectivity of Cystoid Spaces in Diabetic Macular Edema

2012-02-13

Objective: To study the characteristics of the reflectivity of the cystoid spaces and serous retinal detachment (SRD) on spectral-domain optical coherence tomography (SD-OCT) and the correlation with fluorescein findings in diabetic macular edema (DME). Design: Retrospective, observational, cross-sectional study. Participants: Consecutive 134 eyes of 114 patients with clinically significant macular edema for whom SD-OCT and fluorescein angiography (FA) were performed on the same day. Methods: Fluorescein angiography using Heidelberg Retina Angiograph 2 (Heidelberg Engineering, Heidelberg, Germany) and OCT images using Spectralis OCT (Heidelberg Engineering) were obtained. The reflectivity of the cystoid spaces and SRD on the OCT images was evaluated qualitatively and quantitatively and compared with the fluorescein pooling intensity on FA images. Main Outcome Measures: The relationship between the fluorescein pooling and the reflectivity characteristics of the cystoid spaces on SD-OCT images. Results: A total of 141 cystoid spaces in 101 eyes were delineated on OCT images, and 138 spaces (97.9%) had fluorescein pooling. Fifty-five cystoid spaces (39.9%) with marked fluorescein pooling intensity had lower reflectivity on OCT images than those with modest pooling (12.1±10.4 vs. 22.0±15.4, P < 0.001). The heterogeneity of the reflectivity of the cystoid spaces on the OCT images was associated significantly (P < 0.001) with modest fluorescein pooling. The hyperreflective foci in the cystoid spaces were correlated significantly with modest fluorescein pooling and higher or heterogeneous reflectivity on OCT images (P < 0.001, P < 0.001, and P=0.005, respectively). In addition, the cystoid spaces with microaneurysms had higher or heterogeneous reflectivity on OCT images more frequently than those without microaneurysms (P < 0.001 and P=0.019, respectively). The reflectivity levels in the SRD were significantly (P=0.005) lower than in the cystoid spaces, and only 1 eye (3.3%) had heterogeneous reflectivity on OCT images. Conclusions: The results provided a novel interpretation of fluorescein pooling and OCT characteristics of cystoid spaces and SRD in DME and suggested several mechanisms by which the blood–retinal barrier is disrupted and concomitant edematous changes develop. Financial Disclosure(s): The author(s) have no proprietary or commercial interest in any materials discussed in this article.

Correlation of Fundus Autofluorescence with Spectral-Domain Optical Coherence Tomography and Vision in Diabetic Macular Edema

Hyewon Chung, Byeongjun Park, Hyun Jin Shin, Hyung Chan Kim — 2012-02-20

Purpose: To investigate the correlation between fundus autofluorescence (FAF) and the results of spectral-domain optical coherence tomography (SD-OCT) as well as visual acuity (VA) in patients with diabetic macular edema (DME) and to determine the visual prognostic factors. Design: Retrospective, interventional case series. Participants: Sixty-one patients with DME who underwent intravitreal injection of bevacizumab (IVB) as their first treatment. Methods: An assessment of VA and FAF and SD-OCT images were obtained before and after IVB (pre- and post-IVB). Foveal FAF was graded on a scale of 1 to 4. The presence or absence of FAF at the foveola was also determined. Main Outcome Measures: The association of FAF with VA and the SD-OCT results, including central macular thickness (CMT), outer nuclear layer thickness, the integrity of the external limiting membrane (ELM), and the integrity of the junction between the inner and outer segment of the photoreceptor (IS/OS). Results: Better VA, preservation of the ELM, and IS/OS pre-IVB were associated with better VA post-IVB. Of the types of DME, cystoid macular edema significantly correlated with increased FAF at the foveola. A higher level of FAF was 5.6 times more likely to occur in DME with a defect in IS/OS and 10 times more likely to occur with each 10-μm increase in CMT. Each increase by a factor of 0.1 in the logarithm of the minimum angle of resolution (logMAR) pre-IVB increased the probability of high FAF by a factor of 1.73. Despite severe DME, fewer eyes with a low level of FAF exhibited an IS/OS defect and large logMAR VA than eyes with a high level of FAF with severe DME pre-IVB. The average grade of FAF pre-IVB was higher in patients with decreased vision during follow-up than in patients with increased or unchanged good vision. Conclusions: The strong association of FAF with SD-OCT parameters and VA in patients with DME could aid in the prediction of the restoration of photoreceptor integrity and subsequent visual recovery, especially in patients with severe DME, in whom photoreceptor integrity before treatment could not be adequately evaluated, even with SD-OCT. Financial Disclosure(s): The authors have no proprietary or commercial interest in any of the materials discussed in this article.

Enhanced Depth Imaging Optical Coherence Tomography of Choroidal Nevus in 104 Cases

2012-01-31

Purpose: To describe the characteristics of choroidal nevus using the enhanced depth imaging (EDI) feature of spectral-domain optical coherence tomography (OCT). Design: Retrospective, observational case series. Participants: One hundred four eyes with choroidal nevus. Methods: Spectral-domain EDI OCT was performed with a Heidelberg Spectralis HRA+OCT (Heidelberg Engineering, Heidelberg, Germany) using a custom scan acquisition protocol of up to 13 raster lines of 9-mm scan length with automatic real-time image averaging set at 100 images. The thickness of choroidal nevus was measured by combining Heidelberg's autosegmentation with manual segmentation. Main Outcome Measures: Imaging features and thickness correlation of choroidal nevus by EDI OCT versus standard ultrasonography. Results: Of 104 eyes with choroidal nevus imaged with EDI OCT, 51 (49%) displayed image detail suitable for study. The remaining 53 cases were suboptimal because of statistically identified factors of age older than 60 years (P = 0.027), female gender (P = 0.008), extramacular location of nevus (P<0.001), mean distance from foveola more than 3 mm (P = 0.002), mean distance from optic disc more than 4 mm (P<0.001), and mean maximal basal diameter more than 5 mm (P = 0.006). Of the 51 suitable cases, mean nevus thickness was 685 μm (median, 628 μm; range, 184–1643 μm) by EDI OCT compared with 1500 μm (median, 1500 μm; range, 1000–2700 μm) by ultrasonography. The most common EDI OCT imaging features included partial (59%) or complete (35%) choroidal shadowing deep to the nevus, choriocapillaris thinning overlying the nevus (94%), retinal pigment epithelial (RPE) atrophy (43%), RPE loss (14%), RPE nodularity (8%), photoreceptor loss (43%), inner segment–outer segment junction (IS–OS) irregularity (37%), IS–OS loss (6%), external limiting membrane irregularity (18%), outer nuclear and outer plexiform layer irregularity (8%), and inner nuclear layer irregularity (6%). Overlying subretinal fluid was identified by EDI OCT (16%), ophthalmoscopic examination (8%), and ultrasonographic evaluation (0%). A comparison of pigmented versus nonpigmented nevus showed only 1 significant difference of more intense choroidal shadowing with pigmented nevus (P = 0.046). Conclusions: Imaging of choroidal nevus with EDI OCT enables precise measurement of tumor thickness with comparatively reduced thickness relative to ultrasonography. Using EDI OCT, 94% of choroidal nevi were found to have overlying choriocapillaris thinning. Financial Disclosure(s): The author(s) have no proprietary or commercial interest in any materials discussed in this article.

Intraoperative Ultrasonography-Guided Positioning of Iodine 125 Plaque Brachytherapy in the Treatment of Choroidal Melanoma

2012-01-31

Purpose: To report intraoperative ultrasonography-guided positioning of iodine 125 (I125) plaques for brachytherapy of choroidal melanoma as a quality improvement measure. Design: Retrospective, single-center, consecutive case-cohort study. Participants: One hundred fifty consecutive patients with choroidal melanoma. Methods: Patients with choroidal melanoma who were treated with I125 plaque brachytherapy from January 2007 through January 2011 with at least 6 months of clinical follow-up were included. Main Outcome Measures: Patient and tumor characteristics at diagnosis were tabulated. The need for plaque repositioning if intraoperative ultrasonography showed the plaque to be either not centered on the tumor or if there was less than 1.0 mm of plaque margin beyond the tumor border was recorded. The rate of local treatment failure and occurrence of distant metastasis were determined. Results: The average interval from surgery to last follow-up was 21.5 months. Fifty-four (36%) of 150 patients required plaque repositioning. Of tumors located in the macula, equator, and periphery, 15 (36.6%), 26 (36.6%), and 13 (34.2%) required repositioning. There was no case of local treatment failure during a mean follow-up of 21.5 months (range, 6–48 months). Clinical evidence of choroidal melanoma metastasis developed in 9 patients. The cumulative 2-year Kaplan-Meier rate of local treatment failure in the cohort was statistically lower compared with the Collaborative Ocular Melanoma Study, which did not require ultrasonography-guided plaque positioning. Conclusions: Intraoperative ultrasonography identified the need to reposition I125 plaques to achieve centration and plaque margin (>1.0 mm) beyond the tumor border in 36% of eyes. Neither tumor size nor tumor location correlated with the need to reposition the plaque. There was no case of local treatment failure during follow-up in this series. Correct plaque position is an essential component of quality outcomes in brachytherapy. Intraoperative ultrasonography reduces geographic errors in placement in eye plaque therapy and may help to reduce local treatment failure in choroidal melanoma. Financial Disclosure(s): The author(s) have no proprietary or commercial interest in any materials discussed in this article.

American Joint Committee on Cancer T Category for Eyelid Sebaceous Carcinoma Correlates with Nodal Metastasis and Survival

2012-02-13

Purpose: To determine whether T category of the American Joint Committee on Cancer (AJCC) TNM staging system for eyelid carcinoma, 7th edition, correlates with lymph node metastasis, distant metastasis, and survival in patients with sebaceous carcinoma of the eyelid. Design: Retrospective, cohort study. Participants: Fifty consecutive patients treated by 1 author (BE) for eyelid sebaceous carcinoma between May 1999 and August 2010. Methods: Each tumor was staged according to the AJCC 7th edition TNM criteria. The Kaplan-Meier method was used to determine associations between disease-specific survival and (1) T category at presentation, (2) lymph node metastasis, and (3) distant metastasis. Main Outcome Measures: T category at presentation, nodal metastasis, survival. Results: The study included 37 women and 13 men (median age, 68.5 years; range, 44–86 years). Forty-four patients were white, 5 were Hispanic, and 1 was Asian. TNM designations were TXN0M0, 7 patients; T1N0M0, 4 patients; T2aN0M0, 12 patients; T2bN0M0, 11 patients; T2bN1M0, 2 patients; T2bN1M1, 1 patient; T3aN0M0, 2 patients; T3aN1M0, 5 patients; T3bN0M0, 1 patient; T3bN1M0, 1 patient; T3bN0M1, 2 patients; T4N0M0, 1 patient; and T4N0M1, 1 patient. T category at presentation was significantly associated with lymph node metastasis (P = 0.0079). No tumors with T category better than T2b or smaller than 9 mm in greatest dimension were associated with nodal metastasis. Five patients (10%) died of disease during follow-up. Their TNM designations were T2bN1M1, 1 patient; T3bN0M1, 2 patients; T4N0M0, 1 patient; and T4N0M1, 1 patient. No tumors smaller than 12 mm in greatest dimension were associated with distant metastasis or death. T category was significantly associated with disease-specific survival (P = 0.0009). Disease-specific survival was poorer among patients with T category of T3a or worse (P = 0.035). Conclusions: T category in the 7th edition of the AJCC TNM staging system for eyelid carcinoma correlates with outcomes in patients with sebaceous carcinoma of eyelid. On the basis of the present findings, it seems reasonable to recommend sentinel lymph node biopsy or at least strict regional lymph node surveillance for patients with eyelid sebaceous carcinoma with tumors of T category T2b or worse or 10 mm or more in greatest dimension. Financial Disclosure(s): The author(s) have no proprietary or commercial interest in any materials discussed in this article.

Voriconazole for Fungal Corneal Ulcers

Swapnil Parchand, Amit Gupta, Jagat Ram, Nishant Gupta, Arunaloke Chakrabarty — 2012-05-01

There are promising reports in literature suggesting that newer generation triazole agents like voriconazole may overcome the significant shortcomings of commonly used antifungals such as poor ocular penetration, fungistatic nature, drug stability, lack of broad-spectrum coverage, and suboptimal aqueous concentration. To the best of our knowledge, no study has compared efficacy of voriconazole with conventional antifungal treatment in severe keratomycosis, in a prospective randomized clinical trial. In this prospective randomized study, we compared the efficacy of oral and topical voriconazole with that of conventional antifungal treatment.

Spontaneous Regression of Intraocular Lymphoma

Satoru Kase, Kenichi Namba, Xue-Hai Jin, Kanako C. Kubota, Susumu Ishida — 2012-05-01

Intraocular lymphoma (IOL) is a rare malignancy of the eye, often seen in the context of central nervous system lymphoma. Cytological examination of intraocular specimens remains the gold standard for the diagnosis of primary IOL, but measurement of the interleukin (IL)-10 concentration and gene rearrangement can be helpful. We herein report an IOL case showing spontaneous regression, verified by clinico-histopathological analyses.

Measurement of Peripheral Eye Length

Xiaohu Ding, Mingguang He — 2012-05-01

Recent evidence support the importance of peripheral refraction and eye shape in the development of myopia. The method for peripheral refraction appears to be well established; however, the measurement of peripheral eye length (PEL) is less successful. Magnetic resonance imaging (MRI) and optical low-coherence interferometry have been used, but they are expensive, less accessible, and therefore limit their use in clinical assessment. In this study, we propose a new method to measure the PEL, using IOLMaster (Carl Zeiss Meditec, Jena, Germany), and we also assessed its repeatability and correlation with peripheral refraction.

Practice Guidelines

George L. Spaeth — 2012-05-01

A recent editorial by Lum, Rapuano, and Coleman deals with an extremely important issue, specifically practice guidelines and the quality of care. In this well-written editorial, the authors point out that there was much disagreement between available guidelines regarding the diagnosis and care for patients with primary open-angle glaucoma, and they note that such disagreement is not unexpected. However, they went on to comment that there was also “… a fair degree of agreement among the different major recommendations.” They conclude, “Thus, despite differences in the quality of guideline development processes and reporting, clinical guidelines around the world are iterating toward convergence on the clinical management of primary open-angle glaucoma.”

Author reply

Flora Lum, Christopher J. Rapuano, Anne L. Coleman — 2012-05-01

We appreciate feedback from Dr. Spaeth, who as always adds depth and perspective to the matters at hand. The Academy's Preferred Practice Patterns (PPPs) are based on evaluations of the scientific evidence with literature reviews and methodological ratings of studies, which would ideally avoid supporting any treatments such as “bleeding, arsenicals and enemas.” However, there are gaps in the literature, and we differentiate ratings of recommendations in the PPP, which are based on strong scientific evidence vs. recommendations supported by consensus and clinical practice patterns. The PPPs are reviewed annually in recognition that our knowledge and guideline development is ever evolving to match the current level of our knowledge.

Resident Cataract Surgery

Gianluca Carifi — 2012-05-01

I read with interest the article from Woodfield et al on the very important topic represented by training in cataract surgery. They stated that “year of residency was not a significant predictor of increased complication rates” and, “with thoughtful preoperative evaluation and case selection, first-year residents also may be able to begin learning phacoemulsification.”

Author reply

Alonzo S. Woodfield, Emily W. Gower, Sandra D. Cassard, Saraswathy Ramanathan — 2012-05-01

We read with interest the comments of Dr. Carifi and appreciate his feedback. Dr. Carifi's comments regarding risk factor stratification and surgical experience driving complication rates are at the crux of our study question. As we examined the data, it became evident that we had to elucidate the reason that second-year residents did not have an increased complication rate when compared with their third-year counterparts. Many factors appear to contribute to this finding, including preoperative risk factors, resident skill level, and teaching methodology.

Repeat Keratoplasty for Keratoconus

Jatin N. Ashar, Shivani Pahuja, Pravin K. Vaddavalli — 2012-05-01

We read with interest the article by Kelly et al on repeat penetrating corneal transplantation in patients with keratoconus. Keratoconus patients usually have good outcome after penetrating keratoplasty in terms of graft survival and visual acuity. The authors herein have presented a large cohort of patients that underwent a repeat penetrating keratoplasty for a failed keratoplasty performed for keratoconus.

Author reply

Douglas J. Coster, Keryn A. Williams — 2012-05-01

We appreciate the opportunity to respond to the letter from Drs. Ashar, Pahuja, and Vaddavalli. Although the results of corneal transplantation for keratoconus are satisfactory in the short and intermediate term, many grafts fail in the longer term. Corneal transplants may have a half-life shorter than the life expectancy of young recipients. For this reason, the fate of repeat grafts performed for keratoconus is of particular interest.

Head Posture in Down Syndrome

Gregg T. Lueder, Brian Arthur, Sylvia R. Kodsi, Burton Kushner, Richard Saunders — 2012-05-01

In their recent article, Dumitrescu et al found that incomitant strabismus was the most common identifiable cause of abnormal head posture (AHP) in children with Down syndrome (DS). We want to draw attention to another cause of AHP in children with DS, which we reported in 2004. In our patients, children presented with head tilts due to comitant esotropia, which decreased in their preferred head posture. Six of the 7 patients in our study had Down syndrome.

Author reply

2012-05-01

Thank you for the opportunity to respond to the letter from Lueder et al, with regard to our recent paper. We thank Lueder et al for carefully reading our manuscript and providing valuable comments and suggestions regarding the cause of abnormal head posture (AHP) in children with Down syndrome (DS). We agree that the data presented in their 2004 study is germane, and thank them for bringing it to our attention.

Dietary Vitamin D and AMD

Cedric Annweiler, Dan Milea, Olivier Beauchet — 2012-05-01

Seddon et al recently reported the results of an interesting case series study on the association of vitamin D dietary intakes with age-related macular degeneration (AMD) among 14 monozygotic twin pairs with discordant AMD phenotypes. The authors found higher dietary intakes of vitamin D in the twins with early AMD compared to co-twins with more severe AMD (200.3±18.5 IU/day versus 170.9±16.9 IU/day respectively, P=0.01), adjusted for smoking and age. Their findings suggest that some nutritional factors, and more specifically dietary vitamin D, could be involved in the etiology of AMD, in addition to genetic susceptibility. Furthermore, dietary vitamin D intakes might even influence the stage of AMD, since twins with low vitamin D intakes were more exposed to the development of severe AMD compared with their co-twins with higher intakes. We recognize the contribution of this study to the growing body of knowledge about the nonskeletal effects of vitamin D, including its anti-inflammatory and antiangiogenic properties. However, we strongly feel that measuring dietary vitamin D intake is only an approximate and insufficient method of assessment of the actual vitamin D status in the body, which may lead to misinterpretations.

Author reply

Johanna M. Seddon, Robyn Reynolds, Bernard Rosner — 2012-05-01

In our recent article, “Smoking, dietary betaine, methionine and vitamin D in monozygotic twins with discordant macular degeneration: epigenetic implications,” we report associations between dietary nutrients and advanced age-related macular degeneration (AMD), including increased risk of AMD with smoking, reduced risk of advanced AMD with increased dietary intake of methionine, betaine, and vitamin D. Annweiler et al suggest that serum 25(OH)D concentration “may be a more effective indicator of vitamin D status.” Although serum measurements of vitamin D provide data about all sources of vitamin D, our study focused on dietary intake of vitamin D. Dietary intake contributes valuable information about the potential role of vitamin D in the pathogenesis of AMD, as well as other health outcomes such as hypertension and colorectal adenoma. In studies by Forman and Oh, the major sources of vitamin D (milk and dairy products) were measured and were shown to predict plasma vitamin D levels.

Bevacizumab for Retinopathy of Prematurity

Michael W. Stewart — 2012-05-01

The recent editorial by Moshfeghi and Berrocal closely scrutinized the findings and recommendations of the Bevacizumab Eliminates the Angiogenic Threat of Retinopathy of Prematurity (BEAT-ROP) trial. Since the positive results of the trial could revolutionize the treatment of zone 1 and possibly zone 2 ROP, I believe that 2 of the points from the editorial deserve further discussion.

Author reply

Darius M. Moshfeghi, Audina M. Berrocal — 2012-05-01

We read with interest the comments by Dr. Stewart to our editorial and the Bevacizumab Eliminates the Angiogenic Threat of Retinopathy of Prematurity (BEAT-ROP) trial recommendations. We agree and highlighted in our editorial that there is ample evidence to suggest that bevacizumab does indeed leave the eye by passing through the retina, unlike as suggested in the BEAT-ROP trial article. Additionally, we highlighted the nonstatistically significant, yet clinically concerning, rate of mortality (all of which was pulmonary-related) in the bevacizumab cohort compared with the laser cohort. We noted that a potential complication from bevacizumab was failure of the pulmonary alveoli to mature, which could potentially explain these findings.

Familial Exudative Vitreoretinopathy

Fatson Liche, Ajit B. Majji — 2012-05-01

We read with interest the article, “Clinical presentation of familial exudative vitreoretinopathy” by Ranchod et al published in the October 2011 issue. We congratulate the authors for addressing a pertinent topic, and we seek a few clarifications regarding the methodology and data analysis. This article, based on the authors' 25-year experience, highlights very important information on the clinical presentation of familial exudative vitreoretinopathy (FEVR).

Ophthalmology

Editorial Board

This Issue At A Glance

A Simple Vista en Este Número

This Issue At A Glance

Contents

Femto Future: Sizzle or Steak?

Early Experience with the Femtosecond Laser for Cataract Surgery

Genetic Polymorphisms in DNA Repair Genes OGG1, APE1, XRCC1, and XPD and the Risk of Age-Related Cataract

Pathologic Assessment of Complications with Asymmetric or Sulcus Fixation of Square-Edged Hydrophobic Acrylic Intraocular Lenses

Postcataract Surgery Endophthalmitis in the United States: Analysis of the Complete 2003 to 2004 Medicare Database of Cataract Surgeries

Comparative Study of Limbal Stem Cell Deficiency Diagnosis Methods: Detection of MUC5AC mRNA and Goblet Cells in Corneal Epithelium

Allogenic Limbo-keratoplasty with Conjunctivoplasty, Mitomycin C, and Amniotic Membrane for Bilateral Limbal Stem Cell Deficiency

Giant Ocular Surface Squamous Neoplasia Managed with Interferon Alpha-2b as Immunotherapy or Immunoreduction

New Strategy for Rapid Diagnosis and Characterization of Keratomycosis

Risk Factors for the Development of Retroprosthetic Membranes with Boston Keratoprosthesis Type 1: Multicenter Study Results

Mapping the Nerve Architecture of Diabetic Human Corneas

Oral Alcohol Administration Disturbs Tear Film and Ocular Surface

Caffeine Increases Tear Volume Depending on Polymorphisms within the Adenosine A2a Receptor Gene and Cytochrome P450 1A2

Glaucoma 2.0: Neuroprotection, Neuroregeneration, Neuroenhancement

Effect of Head and Body Position on Intraocular Pressure

Verteporfin plus Ranibizumab for Choroidal Neovascularization in Age-related Macular Degeneration: Twelve-month MONT BLANC Study Results

Verteporfin plus Ranibizumab for Choroidal Neovascularization in Age-Related Macular Degeneration: Twelve-Month Results of the DENALI Study

Yellow Corneal Ring Associated with Vitamin Supplementation for Age-Related Macular Degeneration

Choroidal Thickness and Volume Mapping by a Six Radial Scan Protocol on Spectral-Domain Optical Coherence Tomography

Vascular Endothelial Growth Factor Trap-Eye for Macular Edema Secondary to Central Retinal Vein Occlusion: Six-Month Results of the Phase 3 COPERNICUS Study

Rapid Assessment of Avoidable Blindness and Diabetic Retinopathy in Chiapas, Mexico

Systemic Soluble Tumor Necrosis Factor Receptors 1 and 2 Are Associated with Severity of Diabetic Retinopathy in Hispanics

Relationship between Fluorescein Pooling and Optical Coherence Tomographic Reflectivity of Cystoid Spaces in Diabetic Macular Edema

Correlation of Fundus Autofluorescence with Spectral-Domain Optical Coherence Tomography and Vision in Diabetic Macular Edema

Enhanced Depth Imaging Optical Coherence Tomography of Choroidal Nevus in 104 Cases

Intraoperative Ultrasonography-Guided Positioning of Iodine 125 Plaque Brachytherapy in the Treatment of Choroidal Melanoma

American Joint Committee on Cancer T Category for Eyelid Sebaceous Carcinoma Correlates with Nodal Metastasis and Survival

Voriconazole for Fungal Corneal Ulcers

Spontaneous Regression of Intraocular Lymphoma

Measurement of Peripheral Eye Length

Practice Guidelines

Author reply

Resident Cataract Surgery

Author reply

Repeat Keratoplasty for Keratoconus

Author reply

Head Posture in Down Syndrome

Author reply

Dietary Vitamin D and AMD

Author reply

Bevacizumab for Retinopathy of Prematurity

Author reply

Familial Exudative Vitreoretinopathy